Bulletin of Botanical Research ›› 2023, Vol. 43 ›› Issue (5): 700-710.doi: 10.7525/j.issn.1673-5102.2023.05.007
• Genetic and Breeding • Previous Articles Next Articles
Zhuanzhuan JIANG, Li GONG, Yaling SONG
Received:2023-01-07
Online:2023-09-20
Published:2023-09-05
About author:JIANG Zhuanzhuan(1991—),female,doctor,engaged in the research of molecular genetics of plant resistance.
Supported by:CLC Number:
Zhuanzhuan JIANG, Li GONG, Yaling SONG. The Chloroplast Division Protein PARC6 Affected the Growth of Cotyledon and Leaf in Arabidopsis thaliana[J]. Bulletin of Botanical Research, 2023, 43(5): 700-710.
Add to citation manager EndNote|Ris|BibTeX
URL: https://bbr.nefu.edu.cn/EN/10.7525/j.issn.1673-5102.2023.05.007
Table 1
Primer sequences involved in this study
基因名称 Gene name | 引物序列5′→3′ Primer sequence 5′→3′ | |
|---|---|---|
PCR引物 PCR primer | SCO2 | F:CTTCTTCCTCCATTTTCGTTACACCT |
| SCO2 | R:GTCCATTGTTGAGTTTCACATT | |
| PARC6 | LP:TCTCGCACATTAGTTATGGGC | |
| PARC6 | RP:ATAGGTCTTAACCTGGCGAGC | |
| PARC6 | TP:ATTTTGCCGATTTCGGAAC | |
QPCR引物 QPCR primer | SCO2 | F:AATGGCTTCTTCTTTCACCAATAGTC |
| SCO2 | R:GGTGTCTCGAGGTCTGATACATATAAAA | |
| PARC6 | F:GTCCTTGATGAATCCATGCTTGTCCAG | |
| PARC6 | R:GAAGAGCTTCGATTTCTGCAGCCTCACC | |
| ACTIN2 | F:CCCGATGGGCAAGTCATC | |
| ACTIN2 | R:GAACAAGACTTCTGGGCATCTGA | |
Fig.1
Identification of sco2 and parc6 mutants and expression levelsA.Model of gene structures and DNA mutation sites of sco2. Exons(green),introns (black line),and untranslated regions(white) were indicated;B. henotypes of wild type and sco2 mutant after 8 d;C. Genotyping and PCR analysis of genomic DNA isolated from WT and sco2 mutants,primer positions were indicated in figure A;D.Expression of SCO2 gene in WT and sco2 mutants;E.Model of gene structures and positions of T-DNA in the parc6 mutants.Exons(green),introns(black line),and untranslated regions(white) were indicated;F.Phenotypes of wild type and parc6 mutant after 24 d;G.Genotyping and PCR analysis of genomic DNA isolated from WT and parc6 mutants,primer positions were indicated in figure D;H.Expression of PARC6 gene in WT and parc6 mutants
Fig.5
Effect of different concentrations of sucrose treatment on different linesA.Different lines grew on ?MS medium with different concentrations sucrose after 6 d under normal-light conditions(80 μmol·m2·s-1);B.Chlorophyll fluorescence parameters of different lines grew on different concentrations of sucrose
Fig.7
Analysis of chloroplast thylakoid protein complexA.The thylakoids proteins extracted from 7 d cotyledon of wild type and parc6 mutant and 14 d leaf wild type and parc6 mutant for blue native gel electrophoresis(PSⅡ-SC.PSⅡ super complex;PSⅠ-M.PSⅠ monomer;PSⅡ-D.PSⅡ dimer;LHCⅡ.PSⅡ light-harvesting complex;LHCⅡ-T.PSⅡ light-harvesting complex trimer;LHCⅡ monomer,PSⅡ light-harvesting complex monomer);B.12.5% 2D SDS-PAGE,the red dashed box indicated the photosystem Ⅱ super complex protein
| 1 | RAVEN J A, ALLEN J F.Genomics and chloroplast evolution: what did cyanobacteria do for plants?[J].Genome Biology,2003,4(3):209. |
| 2 | POGSON B J, GANGULY D, ALBRECHT-BORTH V.Insights into chloroplast biogenesis and development[J].Biochimica et Biophysica Acta(BBA)-Bioenergetics,2015,1847(9):1017-1024. |
| 3 | SUMIYA N, FUJIWARA T,ERA A,et al.Chloroplast division checkpoint in eukaryotic algae[J].Proceedings of the National Academy of Sciences of the United States of America,2016,113(47):E7629-E7638. |
| 4 | MIYAGISHIMA S Y.Mechanism of plastid division:from a bacterium to an organelle[J].Plant Physiology,2011,155(4):1533-1544. |
| 5 | CHEN L, SUN B, GAO W,et al.MCD1 associates with FtsZ filaments via the membrane-tethering protein ARC6 to guide chloroplast division[J].The Plant Cell,2018,30(8):1807-1823. |
| 6 | ZHANG Y H, ZHANG X C, CUI H S,et al.Residue 49 of AtMinD1 plays a key role in the guidance of chloroplast division by regulating the ARC6-AtMinD1 Interaction[J].Frontiers in Plant Science,2021,12:1-16. |
| 7 | PORTER K J, CAO L Y, CHEN Y D,et al.The Arabidopsis thaliana chloroplast division protein FtsZ1 counterbalances FtsZ2 filament stability in vitro [J].The Journal of Biological Chemistry,2021,296:100627. |
| 8 | SUN B, ZHANG Q Y, YUAN H,et al.PDV1 and PDV2 differentially affect remodeling and assembly of the chloroplast DRP5B ring[J].Plant Physiology,2020,182(4):1966-1978. |
| 9 | OHASHI Y, MORI T, IGAWA T.Behavior of filamentous temperature-sensitive Z2 (FtsZ2) in the male gametophyte during sexual reproduction processes of flowering plants[J].Protoplasma,2020,257(4):1201-1210. |
| 10 | MIYAGISHIMA S Y, NISHIDA K, MORI T,et al.A plant-specific dynamin-related protein forms a ring at the chloroplast division site[J].The Plant Cell,2003,15(3):655-665. |
| 11 | OKAZAKI K, KABEYA Y, MIYAGISHIMA S Y.The evolution of the regulatory mechanism of chloroplast division[J].Plant Signaling & Behavior,2010,5(2):164-167. |
| 12 | ZHANG M, HU Y, JIA J J,et al.CDP1,a novel component of chloroplast division site positioning system in Arabidopsis [J].Cell Research,2009,19(7):877-886. |
| 13 | GLYNN J M, YANG Y, VITHA S,et al.PARC6,a novel chloroplast division factor,influences FtsZ assembly and is required for recruitment of PDV1 during chloroplast division in Arabidopsis [J].The Plant Journal,2009,59(5):700-711. |
| 14 | ISHIKAWA H, YASUZAWA M, KOIKE N,et al. Arabidopsis PARC6 is critical for plastid morphogenesis in pavement,trichome,and guard cells in leaf epidermis[J].Frontiers in Plant Science,2020,10:1665. |
| 15 | CHEN C, CAO L Y, YANG Y,et al.ARC3 activation by PARC6 promotes FtsZ-ring remodeling at the chloroplast division site[J].The Plant Cell,2019,31(4):862-885. |
| 16 | MECHELA A, SCHWENKERT S, SOLL J.A brief history of thylakoid biogenesis[J].Open Biology,2019,9(1):180237. |
| 17 | BÖRNER T, ALEYNIKOVA A Y, ZUBO Y O,et al.Chloroplast RNA polymerases:role in chloroplast biogenesis[J].Biochimica et Biophysica Acta (BBA) - Bioenergetics,2015,1847(9):761-769. |
| 18 | WANG Y N, JIE W G, PENG X Y,et al.Physiological adaptive strategies of oil seed crop ricinus communis early seedlings(cotyledon vs.true leaf) under salt and alkali stresses:from the growth,photosynthesis and chlorophyll fluorescence[J].Frontiers in Plant Science,2019,9:1939. |
| 19 | ISHIZAKI Y, TSUNOYAMA Y, HATANO K,et al.A nuclear-encoded sigma factor,Arabidopsis SIG6,recognizes sigma-70 type chloroplast promoters and regulates early chloroplast development in cotyledons[J].The Plant Journal,2005,42(2):133-144. |
| 20 | TANZ S K, KILIAN J, JOHNSSON C,et al.The SCO2 protein disulphide isomerase is required for thylakoid biogenesis and interacts with LCHB1 chlorophyll a/b binding proteins which affects chlorophyll biosynthesis in Arabidopsis seedlings[J].The Plant Journal,2012,69(5):743-754. |
| 21 | ALBRECHT V, INGENFELD A, APEL K.Snowy cotyledon 2:the identification of a zinc finger domain protein essential for chloroplast development in cotyledons but not in true leaves[J].Plant Molecular Biology,2008,66(6):599-608. |
| 22 | QI Y F, WANG X M, LEI P,et al.The chloroplast metalloproteases VAR2 and EGY1 act synergistically to regulate chloroplast development in Arabidopsis [J].The Journal of Biological Chemistry,2020,295(4):1036-1046. |
| 23 | QI Y F, LIU X Y, LIANG S,et al.A putative chloroplast thylakoid metalloprotease VIRESCENT3 regulates chloroplast development in Arabidopsis thaliana [J].The Journal of Biological Chemistry,2016,291(7):3319-3332. |
| 24 | JIANG Z Z, ZHU L, WANG Q Y,et al.Autophagy-related 2 regulates chlorophyll degradation under abiotic stress conditions in Arabidopsis [J].International Journal of Molecular Sciences,2020,21(12):4515. |
| 25 | FU A G, HE Z Y, CHO H S,et al.A chloroplast cyclophilin functions in the assembly and maintenance of photosystem Ⅱ in Arabidopsis thaliana [J].Proceedings of the National Academy of Sciences of the United States of America,2007,104(40):15947-15952. |
| 26 | TAMURA K, STECHER G, KUMAR S.MEGA11:molecular evolutionary genetics analysis version 11[J].Molecular Biology and Evolution,2021,38(7):3022-3027. |
| 27 | COPE A L, O'MEARA B C, GILCHRIST M A.Gene expression of functionally-related genes coevolves across fungal species:detecting coevolution of gene expression using phylogenetic comparative methods[J].BMC Genomics,2020,21(1):370. |
| 28 | METEIGNIER L V, GHANDOUR R, MEIERHOFF K,et al.The Arabidopsis mTERF-repeat MDA1 protein plays a dual function in transcription and stabilization of specific chloroplast transcripts within the psbE and ndhH operons[J].New Phytologist,2020,227(5):1376-1391. |
| 29 | HE Y, SHI Y F, ZHANG X B,et al.The OsABCI7 transporter interacts with OsHCF222 to stabilize the thylakoid membrane in Rice[J].Plant Physiology,2020,184(1):283-299. |
| 30 | DUTTA S, CRUZ J A, IMRAN S M,et al.Variations in chloroplast movement and chlorophyll fluorescence among chloroplast division mutants under light stress[J].Journal of Experimental Botany,2017,68(13):3541-3555. |
| 31 | YOSHIDA Y.Insights into the mechanisms of chloroplast division[J].International Journal of Molecular Sciences,2018,19(3):733. |
| 32 | PIPITONE R, EICKE S, PFISTER B,et al.A multifaceted analysis reveals two distinct phases of chloroplast biogenesis during de-etiolation in Arabidopsis [J].eLife,2021,10:e62709. |
| 33 | SUN T H, ZHOU F, HUANG X Q,et al.Orange represses chloroplast biogenesis in etiolated Arabidopsis cotyledons via interaction with TCP14[J].The Plant Cell,2019,31(12):2996-3014. |
| 34 | HSIEH W Y, SUNG T Y, WANG H T,et al.Functional evidence for the critical amino-terminal conserved domain and key amino acids of Arabidopsis 4-Hydroxy-3-methylbut-2-enyl diphosphate reductase[J].Plant Physiology,2014,166(1):57-69. |
| 35 | WU G Z, XUE H W. Arabidopsis β-ketoacyl-[acyl carrier protein] synthase i is crucial for fatty acid synthesis and plays a role in chloroplast division and embryo development[J].The Plant Cell,2010,22(11):3726-3744. |
| [1] | Wanting PENG, Jinyu CHEN, Fan YANG, Xinyu LI, Xinyi GUO, Yi WEI, Hongyi WANG, Zhihui WANG. Comparative Analysis of the Phyllosphere Microbial Diversity among Three Different Grassland Plants [J]. Bulletin of Botanical Research, 2026, 46(3): 531-541. |
| [2] | Haiyan CAO, Kaiwen TIAN, Xiaoyu JIA, Xuefeng HAO, Zhuping JIN. The Role of AtMST1 in Regulating Salt Tolerance via H2S Synthesis in Arabidopsis Revealed by CRISPR/Cas9 Knockout [J]. Bulletin of Botanical Research, 2026, 46(2): 259-269. |
| [3] | Hanshi WANG, Xiao LI, Zhongyi PANG, Yanhui PENG, Ruixue WANG, Taijin ZHANG, Yang LIU, Xiyang ZHAO, Chunli ZHAO, Luping JIANG. Screening of Superior Poplar Clones Based on Multi-Trait Comprehensive Evaluation [J]. Bulletin of Botanical Research, 2026, 46(2): 378-392. |
| [4] | Yuhan LIU, Tingting LI, Liu YANG, Te LI, Gang LIU, Xiuwei WANG. Differences in Leaf Stomatal Traits across Plant Life Forms and Stomatal Distribution Types and Their Associations with Leaf Economic Traits [J]. Bulletin of Botanical Research, 2026, 46(1): 131-144. |
| [5] | Zheng LI, Fengxin CHEN, Yuqi LIU, Mingming LI, Jiacan YIN, Chao LIU, Xinli XIA. Overexpression of the PtrMYB002 gene Inhibits Growth of Arabidopsis thaliana and Enhances Its Drought Resistance [J]. Bulletin of Botanical Research, 2026, 46(1): 67-82. |
| [6] | Baojie TONG, Dongying DAN, Jiawei LI. Research Progress on Heat Tolerance and Regulatory Strategies of Plant Leaves [J]. Bulletin of Botanical Research, 2025, 45(2): 171-180. |
| [7] | Changli ZHAO, Liwei ZHOU, Kerou ZHOU, Yueqi YOU, Zhixiang ZHANG. Population Variation of Leaf Traits and Its Correlation with Environmental Factors of Caragana halodendron [J]. Bulletin of Botanical Research, 2025, 45(2): 277-286. |
| [8] | Yuxin YAN, Meijun HE, Yu LI, Xiaoman YUAN, Xuhui TAN, Ming CHENG, Kai LUO, Lujing LIAO. Whitening and Antioxidant Activities of Leaf Polysaccharide from Dendrobium officinale [J]. Bulletin of Botanical Research, 2025, 45(1): 111-118. |
| [9] | Xueyan WEI, Baomei TAN, Chi ZHANG, Jiabao LI, Xin CHEN. Foliar Epidermal Micromorphology of Eleven Species and One Variety of Simple-Leaved Sorbus [J]. Bulletin of Botanical Research, 2024, 44(4): 517-527. |
| [10] | Yuanyuan SUN, Tianqi YANG, Xingmei AI, Haoran LI, Caibao ZHAO, Xuan ZHANG. Relationship Between the Differences in Leaves Morphology and Structure and Epiphyllous Bud Development of Tropical Water Lily before and after Leaf Expansion [J]. Bulletin of Botanical Research, 2024, 44(4): 528-539. |
| [11] | Xuefeng HAO, Xiaoyu JIA, Haiyan CAO, Chunxia KANG, Yanxi PEI. Isolation and Identification of a Novel Enlarged Leaf Mutant atscamp in Arabidopsis thaliana [J]. Bulletin of Botanical Research, 2024, 44(2): 232-238. |
| [12] | Wei LIU, Ziqiang ZHU. Recent Advances on Plant Root Thermomorphogenesis [J]. Bulletin of Botanical Research, 2024, 44(1): 1-7. |
| [13] | Yuwei YANG, Baohui HE, Xuejiao HAN, Haixiang SHI, Guimin ZHANG, Xinghui LU. Effects of Stand Age on Functional Traits and Understory Soil Physicochemical Properties of Populus tomentosa and Their Coupling Relationships [J]. Bulletin of Botanical Research, 2023, 43(6): 857-867. |
| [14] | Zihong HUANG, Shujun YAN, Qiang YU, Yongxin GUAN, Ling LING, Yuting SUN. Effect of Current Twig Stem Structure on Leaf Spreading Efficiency of Different Oriental Cherry Cultivars [J]. Bulletin of Botanical Research, 2023, 43(6): 900-909. |
| [15] | Meijing OU, Hongyan LI, Qiuju ZHAO, Jiawei LI. Relationship Between Leaf Force-to-punch and Leaf Functional Traits under Different Measurement Methods [J]. Bulletin of Botanical Research, 2023, 43(6): 910-922. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||