Sequencing and Analysis of miRNAs in Vegetative and Reproductive Growths of Ceratopteris pteridoides

doi:10.7525/j.issn.1673-5102.2022.06.011

Abstract

CLC Number:

Q945.41

Jun SUN, Guisheng LI. Sequencing and Analysis of miRNAs in Vegetative and Reproductive Growths of Ceratopteris pteridoides[J]. Bulletin of Botanical Research, 2022, 42(6): 1014-1022.

Figures/Tables 4

Fig.1

Table 1

Conserved miRNAs identified in the two samples

名称 Name	序列 Sequence（5′→3′）	log2比值 log2 ratio^a	Q值 Q-value	第一匹配 1^st hit name^b	覆盖度 Coverage /%	第二匹配 2^nd hit name	覆盖度 Coverage /%
*miR408	UGCACUGCCUCUUCCCUGGCUA	-10.23	1.52E-117	ppt-miR408b	95	smo-miR408	95
miR845b	UGCUCUGAUACCAAGUGUGAG	-5.57	1.24E-09	bdi-miR845	86	ath-miR845a	76
miR6173	AGCCGUAAACGAUGGAUA	-1.54	1.03E-17	hbr-miR6173	90	n.a.^c	n.a.
miR5368	AGAGACAGUCCCAGGUAGACA	-1.30	4.04E-52	gma-miR5368	95	n.a.	n.a.
*miR529d	AGAAGAGAGAGAGCGCAGCCC	-1.08	0	ppt-miR529d	95	pab-miR529e	90
*miR535d	UGACGACGAGAGAGAGCACGC	-0.95	0	ppt-miR535c	100	pab-miR535a	100
*miR156a-5p	UGACAGAAGAGAGUGAGCAC	-0.84	0	ppt-miR156c	100	smo-miR156a	95
miR169a-5p	CAGCCAAGGAUGACUUGCCGA	-0.09	4.09E-04	pde-miR169	90	ath-miR169a-5p	100
miR5245	ACAUCAUAGAACACAGGCAG	-0.01	2.93E-02	mtr-miR5245	90	n.a.	n.a.
*miR390a-5p	AAGCUCAGGAGGGAUAGCGCC	0.25	8.23E-288	ppt-miR390a	100	pta-miR390	100
*miR894	GUUUCACGUCGGGUUCACCA	0.30	0	ppt-miR894	95	nat-miR894	95
miR8155	GUAACCUGGCUCUGAUACCA	0.47	1.61E-28	aof-miR8155	100	cpa-miR8155	100
*miR157d	UGACAGAAGAUAGAGAGCAC	0.56	0	ppt-miR156b	100	smo-miR156b	95
miR5139	AACCUGGCUCUGAUACCA	0.57	4.00E-57	aof-miR5139b	86	cas-miR5139	95
*miR166a-3p	UCGGACCAGGCUUCAUUCCCC	0.60	0	ppt-miR166a	95	smo-miR166b	95
miR5182	UGACAUCUUGGAACACGUGCG	0.60	1.73E-06	bdi-miR5182	76	n.a.	n.a.
*miR166m	UCGGACCAGGCUUCAUUCCCU	0.65	0	ppt-miR166a	95	smo-miR166b	95
*miR165a-3p	UCGGACCAGGCUUCATCCCCU	0.83	1.05E-21	ppt-miR166a	90	smo-miR166b	90
miR168a-5p	UCGCUUGGUGCAGGUCGGGAA	0.85	0	pab-miR168a	100	ath-miR168b-5p	100
miR396c	UCAAGAAAGCUGUGGGAAAAC	0.85	0	pab-miR396e	90	ath-miR396b-3p	86
miR396g-3p	CUCAAGAAAGCUGUGGGAAAA	0.86	0	pab-miR396e	95	ath-miR396b-3p	90
miR8175	CGUUCCCCGGCAACGGCGCCA	1.03	2.86E-194	ath-miR8175	95	n.a.	n.a.
*miR1026a	UGAGAAAUACUUGAGAGGACA	1.05	4.59E-04	ppt-miR1026b	95	n.a.	n.a.
miR5655	AAGUAGACACACAAGAAAGAG	1.06	2.11E-06	ath-miR5655	90	n.a.	n.a.
miR5236a	AAGUUUCGGGCAGAUUUGGUA	1.07	1.00E-06	mtr-miR5236d	81	n.a.	n.a.
miR167a-5p	UGAAGCUGCCAGCAUGAUCUA	1.10	2.11E-10	pab-miR167b	91	ath-miR167a-5p	100
miR950-5p	UCACGUCAGGGCCACGAUGGUU	1.17	1.33E-06	pab-miR950b	100	n.a.	n.a.
miR1312	UUCGGAGAGAAAAUGGCGACAU	1.28	9.31E-04	pab-miR1312a	100	pde-miR1312	95
miR8752	UGGGGAUAGGUAUCUGCA	1.47	2.73E-05	gra-miR8752	81	n.a.	n.a.
*miR160h	UGCCUGGCUCCCUGCAUGCCA	1.63	3.88E-92	ppt-miR160c	95	smo-miR160b	100
miR1314	UCGGCCUCGAAUGUUAGGAGAA	1.74	1.07E-05	pab-miR1314	100	pde-miR1314	95
miR172d	CGAGAAUCUUGAUGAUGCUGC	2.03	0	ath-miR172c	90	osa-miR172d-3p	90
miR5041-3p	AUGUUGAGCAAUUUGAAGAUGAA	2.05	3.53E-06	gma-miR5041-3p	95	n.a.	n.a.
*miR319b	AGCUGCCGCGUCAUGCAUCCA	3.05	0	ppe-miR319b	95	smo-miR319	90
miR159c-5p	GAGCUCCCAUCGGUCCAAUC	3.62	0	zma-miR159d-5p	90	bdi-miR159a-5p	95
*miR1083	UAGCCUGGAACGAAGCACGGG	4.00	0	smo-miR1083	95	pab-miR1083	90
miR397	UAUUGAGUGCAGCGUUGACGG	5.22	1.82E-06	pab-miR397i	100	ath-miR397a	86
miR3630-3p	GGGAAUCUCUCUGAUGCAC	5.52	2.24E-07	vvi-miR3630-3p	86	han-miR3630-3p	77
miR4414a-5p	AGCUGCUGACUCGUUGGCUCA	6.91	1.80E-14	gma-miR4414a-5p	100	mtr-miR4414a-5p	100
miR394a	ACUGGCAUUCUGUCCACCUUC	9.42	2.66E-54	pab-miR394a	85	ath-miR394a	85
miR7806	UGAAGAUGACCGCAUGAGCA	12.30	3.48E-241	rgl-miR7806	90	n.a.	n.a.
miR171a-5p	CGAUAUUGUAGCGGUUCAAUC	12.89	0	ath-miR171c-5p	95	osa-miR171c-5p	95

Table 1

Table 2

Fig.2

References 48

1	RHOADES M W， REINHART B J， LIM L P，et al.Prediction of plant microRNA targets［J］.Cell，2002，110（4）： 513-520.
2	SCHWAB R， PALATNIK J F， RIESTER M，et al.Specific effects of microRNAs on the plant transcriptome［J］.Developmental Cell，2005，8（4）：517-527.
3	XU M L， HU T Q， ZHAO J F，et al.Developmental functions of miR156-regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE（SPL） genes in Arabidopsis thaliana ［J］.PLoS Genetics，2016，12（8）：e1006263.
4	WU G， PARK M Y， CONWAY S R，et al.The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis ［J］.Cell，2009，138（4）：750-759.
5	WU G， POETHIG R S.Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3 ［J］.Development，2006，133（18）：3539-3547.
6	SCHMID M， UHLENHAUT N H， GODARD F，et al.Dissection of floral induction pathways using global expression analysis［J］.Development，2003，130（24）：6001-6012.
7	CHUCK G， CIGAN A M， SAETEURN K，et al.The heterochronic maize mutant Corngrass1 results from overexpression of a tandem microRNA［J］.Nature Genetics，2007，39（4）：544-549.
8	CARDON G H， HÖHMANN S， NETTESHEIM K，et al.Functional analysis of the Arabidopsis thaliana SBP-box gene SPL3：a novel gene involved in the floral transition［J］.The Plant Journal，1997，12（2）：367-377.
9	WANG J W， CZECH B， WEIGEL D.miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana ［J］.Cell，2009，138（4）：738-749.
10	YANG L， XU M L，KOO Y，et al.Sugar promotes vegetative phase change in Arabidopsis thaliana by repressing the expression of MIR156A and MIR156C ［J］.elife，2013，2：e00260.
11	AUKERMAN M J， SAKAI H.Regulation of flowering time and floral organ identity by a microRNA and its APETALA2-like target genes［J］.The Plant Cell，2003，15（11）：2730-2741.
12	CHEN X M.A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development［J］.Science，2004，303（5666）：2022-2025.
13	Ó'MAOILÉIDIGH D S， DVAN DRIEL A， SINGH A，et al.Systematic analyses of the MIR172 family members of Arabidopsis define their distinct roles in regulation of APETALA2 during floral transition［J］.PLoS Biology，2021，19（2）：e3001043.
14	LIAN H， WANG L， MA N，et al.Redundant and specific roles of individual MIR172 genes in plant development［J］.PLoS Biology，2021，19（2）：e3001044.
15	LAUTER N， KAMPANI A， CARLSON S，et al.microRNA172 down-regulates glossy15 to promote vegetative phase change in maize［J］.Proceedings of the National Academy of Sciences of the United States of America，2005，102（26）：9412-9417.
16	EVANS M M， PASSAS H J， POETHIG R S.Heterochronic effects of glossy15 mutations on epidermal cell identity in maize［J］.Development，1994，120（7）：1971-1981.
17	MOOSE S P， SISCO P H.Glossy15 controls the epidermal juvenile-to-adult phase transition in maize［J］.The Plant Cell，1994，6（10）：1343-1355.
18	HYUN Y， RICHTER R， VINCENT C，et al.Multi-layered regulation of SPL15 and cooperation with SOC1 integrate endogenous flowering pathways at the Arabidopsis shoot meristem［J］.Developmental Cell，2016，37（3）：254-266.
19	PRYER K M， SCHUETTPELZ E， WOLF P G，et al.Phylogeny and evolution of ferns （monilophytes） with a focus on the early leptosporangiate divergences［J］.American Journal of Botany，2004，91（10）：1582-1598.
20	CHRISTENHUSZ M J M， CHASE M W.Trends and concepts in fern classification［J］.Annals of Botany，2014，113（4）：571-594.
21	SHEN H， JIN D M， SHU J P，et al.Large-scale phylogenomic analysis resolves a backbone phylogeny in ferns［J］.GigaScience，2018，7（2）：1-11.
22	CONWAY S J， DI STILIO V S.An ontogenetic framework for functional studies in the model fern Ceratopteris richardii ［J］.Developmental Biology，2020，457（1）：20-29.
23	JORDON-THADEN I E， CHANDERBALI A S， GITZENDANNER M A，et al.Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta［J］.Applications in Plant Sciences，2015，3（5）：1400105.
24	HAFNER M， LANDGRAF P， LUDWIG J，et al.Identification of microRNAs and other small regulatory RNAs using cDNA library sequencing［J］.Methods，2008，44（1）：3-12.
25	KANG W J， FRIEDLÄNDER M R.Computational prediction of miRNA genes from small RNA sequencing data［J］.Frontiers in Bioengineering and Biotechnology，2015，3：7.
26	MA X X， TANG Z H， QIN J P，et al.The use of high-throughput sequencing methods for plant microRNA research［J］.RNA Biology，2015，12（7）：709-719.
27	WU L， ZHOU H Y， ZHANG Q Q，et al.DNA methylation mediated by a microRNA pathway［J］.Molecular Cell，2010，38（3）：465-475.
28	FLOYD S K， BOWMAN J L.Distinct developmental mechanisms reflect the independent origins of leaves in vascular plants［J］.Current Biology，2006，16（19）：1911-1917.
29	SUN J， LI G S.Leaf dorsoventrality candidate gene CpARF4 has conserved expression pattern but divergent tasiR-ARF regulation in the water fern Ceratopteris pteridoides ［J］.American Journal of Botany，2020，107（11）：1470-1480.
30	LIU J， LIU X N， ZHANG S J，et al.TarDB：an online database for plant miRNA targets and miRNA-triggered phased siRNAs［J］.BMC Genomics，2021，22（1）：348.
31	GUO Z L， KUANG Z， WANG Y，et al.PmiREN：a comprehensive encyclopedia of plant miRNAs［J］.Nucleic Acids Research，2020，48（D1）：D1114-D1121.
32	YOU C J， CUI J， WANG H，et al.Conservation and divergence of small RNA pathways and microRNAs in land plants［J］.Genome Biology，2017，18（1）：158.
33	BERRUEZO F， DE SOUZA F S J， PICCA P I，et al.Sequencing of small RNAs of the fern Pleopeltis minima （Polypodiaceae） offers insight into the evolution of the microrna repertoire in land plants［J］.PLoS One，2017，12（5）：e0177573.
34	CHO S H， CORUH C， AXTELL M J.miR156 and miR390 regulate tasiRNA accumulation and developmental timing in Physcomitrella patens ［J］.The Plant Cell，2012，24（12）：4837-4849.
35	TSUZUKI M， NISHIHAMA R， ISHIZAKI K，et al.Profiling and characterization of small RNAs in the liverwort，Marchantia polymorpha，belonging to the first diverged land plants［J］.Plant and Cell Physiology，2015，57（2）：359-372.
36	AXTELL M J， BARTEL D P.Antiquity of microRNAs and their targets in land plants［J］.The Plant Cell，2005，17（6）：1658-1673.
37	ZUMAJO-CARDONA C， PABÓN-MORA N， AMBROSE B A.The evolution of euAPETALA2 genes in vascular plants：from plesiomorphic roles in sporangia to acquired functions in ovules and fruits［J］.Molecular Biology and Evolution，2021，38（6）：2319-2336.
38	GUO C K， XU Y M， SHI M，et al.Repression of miR156 by miR159 regulates the timing of the juvenile-to-adult transition in Arabidopsis ［J］.The Plant Cell，2017，29（6）：1293-1304.
39	XUE X Y， ZHAO B， CHAO L M，et al.Interaction between two timing microRNAs controls trichome distribution in Arabidopsis ［J］.PLoS Genetics，2014，10（4）：e1004266.
40	NATARAJAN B， BANERJEE A K.MicroRNA160 regulates leaf curvature in potato （Solanum tuberosum L.cv.Désirée）［J］.Plant Signaling & Behavior，2020，15（5）：1744373.
41	MALLORY A C， BARTEL D P， BARTEL B.MicroRNA - directed regulation of Arabidopsis AUXIN RESPONSE FACTOR17 is essential for proper development and modulates expression of early auxin response genes［J］.The Plant Cell，2005，17（5）：1360-1375.
42	REN W Q， WANG H， BAI J J，et al.Association of microRNAs with types of leaf curvature in Brassica rapa ［J］.Frontiers in Plant Science，2018，9：73.
43	SONG J B， HUANG S Q， DALMAY T，et al.Regulation of leaf morphology by microRNA394 and its target LEAF CURLING RESPONSIVENESS ［J］.Plant and Cell Physiology，2012，53（7）：1283-1294.
44	ZHANG J P， YU Y， FENG Y Z，et al.MiR408 regulates grain yield and photosynthesis via a phytocyanin protein［J］.Plant Physiology，2017，175（3）：1175-1185.
45	LI W X， OONO Y， ZHU J H，et al.The Arabidopsis NFYA5 transcription factor is regulated transcriptionally and posttranscriptionally to promote drought resistance［J］.The Plant Cell，2008，20（8）：2238-2251.
46	ZHAO M， DING H， ZHU J K，et al.Involvement of miR169 in the nitrogen-starvation responses in Arabidopsis ［J］.New Phytologist，2011，190（4）：906-915.
47	BORGES F， PARENT J S， VAN EX F，et al.Transposon-derived small RNAs triggered by miR845 mediate genome dosage response in Arabidopsis ［J］.Nature Genetics，2018，50（2）：186-192.
48	HUANG S L， ZHOU J J， GAO L，et al.Plant miR397 and its functions［J］.Functional Plant Biology，2021，48（4）：361-370.

miRNA	靶基因 Target gene	结合位点 Binding site（5′→3′）	log2比值 log2 ratio^*	FDR
miR408	CL11590.Contig2_All	CUGUCAGGAAGAGGCAGUGCG	0.95	6.06E-05
	CL1188.Contig1_All	UAAGCAGGGAAGAGGCAGUGCU	1.45	2.87E-18
	CL1513.Contig2_All	UAAGCAGGGAAGAGGCAGUGCU	2.32	3.87E-12
	CL3116.Contig6_All	GGGUUGGGGAAGAGGCAGUGCA	1.86	3.46E-02
	Unigene13203_All	UCGCAAGGGAAGAGGCAGUGCA	2.67	0
miR156a-5p	CL3137.Contig2_All	GUGCUCUCUCUCUUCAGUCA	1.47	2.44E-70
	Unigene24729_All	GUGCUCUCUCUCUUCAGUCA	1.37	3.64E-56
	CL7715.Contig3_All	GUGCUCUCUCUCUUCUGUCA	1.31	1.26E-28
	CL5455.Contig2_All	GUGCUCUCUCUCUUCUGUCA	1.22	2.29E-26
miR169a-5p	CL881.Contig4_All	UCAGGCAAUUCAUUCUUGGCUU	2.71	1.22E-04
miR169a-5p	CL881.Contig2_All	UAGGCAAUUCAUUCUUGGCUU	0.93	3.89E-14
miR394a	Unigene29847_All	GAGAGGUGGACAGAAUGCCACA	-2.04	0
miR172d	CL465.Contig1_All	GCAGCAUCAUCAGGAUUCUCA	0.27	1.08E-06
	CL295.Contig3_All	GCAGCAUCAUCAGGAUUCUCA	-0.05	9.60E-01
	Unigene21783_All	GCAGCAUCAUCAGGAUUCUCA	-1.92	1.02E-26
miR845b	CL12834.Contig4_All	UUCACAGUGGUAUCAGAGCA	-1.29	4.94E-09
	CL138.Contig3_All	UUCUUACAUGGUAUCAGAGCU	-0.46	3.74E-03
	CL3488.Contig4_All	UUCACAGUGGUAUCAGAGCA	-0.91	1.35E-04
miR171a-5p	Unigene13102_All	GAUUGAGCCGCGCCAAUAUCG	0.19	6.26E-22
miR166	CL784.Contig5_All	CUGGAAUGAAGCCUGGUCCUGA	1.35	3.50E-04
	Unigene9392_All	CUGGGAUGAAGCCUGGUCCGG	1.48	1.16E-20
	CL1122.Contig2_All	CUGGAAUGAAGCCUGGUCCUGA	0.33	5.70E-01
	CL1909.Contig6_All	CUGGAAUGAAGCCUGGUCCGG	1.30	2.24E-02
	CL575.Contig12_All	CUGGGAUGAAGCCUGGUCCGG	1.20	3.95E-13
miR160h	Unigene18882_All	AGGCAUGCAGGGAGCCAGGCA	0.71	1.19E-41
	Unigene9932_All	AGGCAUGCAGGGAGCCAGGCA	-0.03	6.41E-01
	CL2591.Contig2_All	AGGCAUGCAGGGAGCCAGGCA	0.83	1.90E-01
miR159c-5p	CL8045.Contig1_All	GAUUGGACUGAAGGGAGCUC	1.26	5.10E-03
miR159c-5p	Unigene36353_All	AAUUGGACUGAAGGGAGCUC	7.14	1.79E-40
miR319b	CL12713.Contig3_All	GGCAGCUCCCUUCAGUCCAA	0.84	3.26E-01
	CL8045.Contig1_All	UAGAGCUCCCUUCAGUCCAA	1.26	5.10E-03
	Unigene36353_All	UCGAGCUCCCUUCAGUCCAA	7.14	1.79E-40
miR397	CL6968.Contig1_All	AUAACUCAAGACGCAACUGUC	1.48	4.60E-12

[1]	Yamei LIU, Yupeng WU, Limei LI, Min SU, Zhu YU, Lejun OUYANG. Differential Expression of miRNA396 and CKX Genes in Eucalyptus urophylla × E. grandis Callus Induced by Different Concentrations of Novel Mitogen PBU [J]. Bulletin of Botanical Research, 2022, 42(5): 840-847.
[2]	ZHOU Min, JIANG Dan, LIU Yue-Xiu, WANG Xiao-Rong, TANG Hao-Ru, CHEN Qing. amiRNA-mediated PL Gene Silencing Driven by the Fruit-specific Promoter P119 in Strawberry and Its Effect on Fruit Firmness [J]. Bulletin of Botanical Research, 2019, 39(3): 441-449.
[3]	XIONG Xue-Mei;WU Ying;*;WANG Yang. Research Progresses in the Regulation of miRNAs Biogenesis and Function in Plants [J]. Bulletin of Botanical Research, 2014, 34(2): 282-288.
[4]	YANG Hui-Qin;JIANG Jing;LIU Ming-Ying;QIAO Gui-Rong;JIANG Yan-Cheng;ZHUO Ren-Ying*. Construction of Expression Vector of ptc-miR801 Gene and Function Analysis [J]. Bulletin of Botanical Research, 2013, 33(5): 599-604.
[5]	ZHAI Jun-Miao;LUAN Yu-Shi*;CUI Juan-Juan. Evolution and Function Analysis of miR396 Gene Family [J]. Bulletin of Botanical Research, 2013, 33(4): 421-428.
[6]	BAO Qian;XU Tao;ZHANG Fu-Chun. Cloning of miR417 Gene from Halostachys caspica* and Its Effects on the Rates of Seed Germination and Seedling Survival [J]. Bulletin of Botanical Research, 2011, 31(4): 408-413.

Sequencing and Analysis of miRNAs in Vegetative and Reproductive Growths of Ceratopteris pteridoides

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 4

References 48

Related Articles 6

Recommended Articles

Metrics

Comments