Analysis of SHMT Gene Family and Production of PtrSHMT9 Mutant in Populus trichocarpa

doi:10.7525/j.issn.1673-5102.2020.06.013

Abstract

Abstract:

Serine hydroxy methyltransferases（SHMTs） played an important role in the one-carbon（C1） metabolism pathway in plant cells. We identified 9 SHMT genes from the genome of Populus trichocarpa. Populus eFP resource showed that 7 PtrSHMTs were expressed in multiple tissues， among which PtrSHMT9 was the most highly expressed gene in xylem. By analysis of RT-PCR and Aspwood， PtrSHMT9 had a high level in secondary wall thickening of stem wood tissue， suggested its involvement in poplar wood formation. Using Cas9/gRNA technique， PtrSHMT9-edited mutants were prepared and 4 different ptrshmt9 knockouts were obtained. Our results provided basic information and genetic material for exploring the function of SHMT and PtrSHMT9 in trees.

Key words: Populus trichocarpa, SHMT, ptrshmt9mutant, Cas9/gRNA

CLC Number:

S792.11

Bing LI, Yu-Xiang CHENG. Analysis of SHMT Gene Family and Production of PtrSHMT9 Mutant in Populus trichocarpa[J]. Bulletin of Botanical Research, 2020, 40(6): 906-912.

Figures/Tables 8

Table1

Table 2

Fig.1

Fig.2

Fig.3

Fig.4

Fig.5

Fig.6

References 25

1	Schirch V，Szebenyi D M.Serine hydroxymethyltransferase revisited［J］.Current Opinion in Chemical Biology，2005，9（5）：482-487.
2	Stover P，Schirch V.Serine hydroxymethyltransferase catalyzes the hydrolysis of 5，10-methenyltetrahydrofolate to 5-formyltetrahydrofolate［J］.Journal of Biological Chemistry，1990，265（24）：14227-14233.
3	Appaji Rao N，Ambili M，Jala V R，et al.Structure-function relationship in serine hydroxymethyltransferase［J］.Biochimica et Biophysica Acta（BBA）-Proteins and Proteomics，2003，1647（1-2）：24-29.
4	Prabhu V，Chatson K B，Abrams G D，et al.¹³C nuclear magnetic resonance detection of interactions of serine hydroxymethyltransferase with C1-tetrahydrofolate synthase and glycine decarboxylase complex activities in Arabidopsis［J］.Plant Physiology，1996，112（1）：207-216.
5	Zhang Y，Sun K H，Sandoval F J，et al.One-carbon metabolism in plants：characterization of a plastid serine hydroxymethyltransferase［J］.The Biochemical Journal，2010，430（1）：97-105.
6	Mcclung C R，Hsu M，Painter J E，et al.Integrated temporal regulation of the photorespiratory pathway.Circadian regulation of two Arabidopsis genes encoding serine hydroxymethyltransferase［J］.Plant Physiology，2000，123（1）：381-392.
7	Voll L M，Jamai A，Renné P，et al.The photorespiratory Arabidopsisshm1 mutant is deficient in SHM1［J］.Plant Physiology，2006，140（1）：59-66.
8	Somerville C R，Ogren W L.Photorespiration-deficient mutants of Arabidopsis thaliana lacking mitochondrial serine transhydroxymethylase activity［J］.Plant Physiology，1981，67（4）：666-671.
9	Jamai A，Salomé P A，Schilling S H，et al.Arabidopsis photorespiratory serine hydroxymethyltransferase activity requires the mitochondrial accumulation of ferredoxin-dependent glutamate synthase［J］.The Plant Cell，2009，21（2）：595-606.
10	Moreno J I，Martín R，Castresana C.Arabidopsis SHMT1，a serine hydroxymethyltransferase that functions in the photorespiratory pathway influences resistance to biotic and abiotic stress［J］.The Plant Journal，2005，41（3）：451-463.
11	Wang D K，Liu H Q，Li S J，et al.Characterization and molecular cloning of a Serine hydroxymethyltransferase 1（OsSHM1） in rice［J］.Journal of Integrative Plant Biology，2015，57（9）：745-756.
12	Liu Y P，Mauve C，Lamothe-Sibold M，et al.Photorespiratory serine hydroxymethyltransferase 1 activity impacts abiotic stress tolerance and stomatal closure［J］.Plant，Cell & Environment，2019，42（9）：2567-2583.
13	Mishra P，Jain A，Takabe T，et al.Heterologous expression of serine hydroxymethyltransferase-3 from rice confers tolerance to salinity stress in E.coli and Arabidopsis［J］.Frontiers in Plant Science，2019，10：217.
14	Zhou H P，Zhao J F，Yang Y Q，et al.Ubiquitin-specific protease16 modulates salt tolerance in Arabidopsis by regulating Na⁺/H⁺ antiport activity and serine hydroxymethyltransferase stability［J］.The Plant Cell，2012，24（12）：5106-5122.
15	Rajinikanth M，Harding S A，Tsai C J.The glycine decarboxylase complex multienzyme family in Populus［J］.Journal of Experimental Botany，2007，58（7）：1761-1770.
16	Letunic I，Doerks T，Bork P.SMART 7：recent updates to the protein domain annotation resource［J］.Nucleic Acids Research，2012，40（D1）：D302-D305.
17	Tamura K，Dudley J，Nei M，et al.MEGA4：molecular evolutionary genetics analysis（MEGA） software version 4.0［J］.Molecular Biology and Evolution，2007，24（8）：1596-1599.
18	Wilkins O，Nahal H，Foong J，et al.Expansion and diversification of the Populus R2R3-MYB family of transcription factors［J］.Plant Physiology，2009，149（2）：981-993.
19	Sundell D，Street N R，Kumar M，et al.AspWood：high-spatial-resolution transcriptome profiles reveal uncharacterized modularity of wood formation in Populus tremula［J］.The Plant Cell，2017，29（7）：1585-1604.
20	Xing H L，Dong L，Wang Z P，et al.A CRISPR/Cas9 toolkit for multiplex genome editing in plants［J］.BMC Plant Biology，2014，14（1）：327.
21	Li S J，Zhen C，Xu W J，et al.Simple，rapid and efficient transformation of genotype Nisqually-1：a basic tool for the first sequenced model tree［J］.Scientific Reports，2017，7（1）：2638.
22	Wang Y S，Harding S A，Tsai C J.Expression of a glycine decarboxylase complex H-protein in non-photosynthetic tissues of Populus tremuloides［J］.Biochimica et Biophysica Acta（BBA）-Gene Structure and Expression，2004，1676（3）：266-272.
23	Hanson A D，Roje S.One-carbon metabolism in higher plants［J］.Annual Review of Plant Physiology and Plant Molecular Biology，2001，52：119-137.
24	Li J F，Norville J E，Aach J，et al.Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9［J］.Nature Biotechnology，2013，31（8）：688-691.
25	Liang Z，Zhang K，Chen K L，et al.Targeted mutagenesis in Zea mays using TALENs and the CRISPR/Cas system［J］.Journal of Genetics and Genomics，2014，41（2）：63-68.

引物名称 Primer name	引物用途 Primer use	引物序列 Primer sequence(5′—3′)
PtrSHMT9-RT	半定量RT-PCR Semi-quantitative PCR	CCTTGTTGCTGCTCAGGAAGCTG; CAGAGCACCAATCTGGTGGTTGTG
DT1-BsF	靶位点gRNA Target site gRNA	ATATATGGTCTCGATTGGGCTTGGATTTGCCTTCAGGTT
DT1-F0		TGGGCTTGGATTTGCCTTCAGGTTTTAGAGCTAGAAATAGC
DT2-R0		AACGCCCTATTCTGGTTCCCCTGAATCTCTTAGTCGACTCTAC
DT2-BsR		ATTATTGGTCTCTAAACGCCCTATTCTGGTTCCCCTG
PtrSHMT9-U/D	位点编辑鉴定 Identifying editing site	ATGGATCCAGTAACTGTGTGG; CCACTGATGTGAGCCATGTC
zCas-U/D	转基因鉴定 Transgenic identification	TGAGAACATCGTCATTGAGATGG; TCAGCTTGTCATTCTCATCGTAC
PtrActin2-U/D	Actin内参基因 Reference gene Actin	AACATGGGATTGTTAGCAACTGG; TCCATCACCAGAATCCAGCACA

基因名 Gene name	基因座位 Gene locus	氨基酸数目 Amino acid
PtrSHMT1	Potri.001G212000	578
PtrSHMT2	Potri.001G320400	471
PtrSHMT3	Potri.002G090200	555
PtrSHMT4	Potri.002G109200	516
PtrSHMT5	Potri.005G170800	552
PtrSHMT6	Potri.006G232300	559
PtrSHMT7	Potri.008G002900	547
PtrSHMT8	Potri.010G254700	520
PtrSHMT9	Potri.017G059300	471

[1]	Zheng LI, Fengxin CHEN, Yuqi LIU, Mingming LI, Jiacan YIN, Chao LIU, Xinli XIA. Overexpression of the PtrMYB002 gene Inhibits Growth of Arabidopsis thaliana and Enhances Its Drought Resistance [J]. Bulletin of Botanical Research, 2026, 46(1): 67-82.
[2]	Lingtong MENG, Liwei SU, Xiangxin LI, Tiansheng XIONG, Panpeng CHANG, Mengzhuo LIU, Chenguang ZHOU. Functional Analysis of ANT Transcription Factor of Populus trichocarpa Based on CRISPR-dCas9 Transcription Activation System [J]. Bulletin of Botanical Research, 2024, 44(3): 431-440.
[3]	Anying HUANG, Dean XIA, Yang ZHANG, Dongchen NA, Qing YAN, Zhigang WEI. Cloning and Drought Tolerance Expression Analysis of PtrWRKY51 Gene in Populus trichocarpa [J]. Bulletin of Botanical Research, 2022, 42(6): 1005-1013.
[4]	Xueying WANG, Ruiqi WANG, Yang ZHANG, Cong LIU, Dean XIA, Zhigang WEI. Genome‑wide Identification and Stress Response Analysis of Cyclic Nucleotide-gated Channels(CNGC) Gene Family in Populus trichocarpa [J]. Bulletin of Botanical Research, 2022, 42(4): 613-625.
[5]	He CHENG, Shuanghui TIAN, Yang ZHANG, Cong LIU, De’an XIA, Zhigang WEI. Genome-wide Identification and Expression Analysis of nsLTP Gene Family in Populus trichocarpa [J]. Bulletin of Botanical Research, 2022, 42(3): 412-423.
[6]	Shuang-Hui TIAN, He CHENG, Yang ZHANG, Cong LIU, De-An XIA, Zhi-Gang WEI. Genome-wide Identification and Expressional Analysis of Carotenoid Cleavage Dioxygenases(CCD) Gene Family in Populus trichocarpa under Drought and Salt Stress [J]. Bulletin of Botanical Research, 2021, 41(6): 993-1005.
[7]	Meng-Xuan REN, Yang ZHANG, Shuang WANG, Rui-Qi WANG, Cong LIU, Zhi-Gang WEI. Genome-wide Identification and Expression Analysis GATA Family of Populus trichocarpa [J]. Bulletin of Botanical Research, 2021, 41(1): 107-118.
[8]	DONG Shi-Wei, YANG Yu-Ning, WANG Nai-Rui, ZHANG Han-Guo, LI Shu-Juan. Gene Cloning and Stress Response Analysis of Natural Disorder Protein in Populus trichocarpa [J]. Bulletin of Botanical Research, 2020, 40(4): 575-582.
[9]	LI Ya-Bo, Lü Jia-Xin, TAN Bing, GAO Cai-Qiu. Cloning and expression analysis of 5 ZFP genes from Poplus trichocarpa [J]. Bulletin of Botanical Research, 2020, 40(2): 243-250.
[10]	WANG Shuang, ZHANG Yang, REN Meng-Xuan, LIU Ying-Ying, WEI Zhi-Gang. Genome-Wide Analysis of the WOX Family Reveals Their Involvement in Stem Growth of Populus trichocarpa [J]. Bulletin of Botanical Research, 2019, 39(4): 568-577.
[11]	WEI Zhen, CHENG Yu-Xiang, XIA De-An. Cas9/gRNA-mediated Targeted PtrFLA31/34 Gene Mutation in Populus [J]. Bulletin of Botanical Research, 2018, 38(5): 741-747.