Bulletin of Botanical Research ›› 2021, Vol. 41 ›› Issue (4): 604-613.doi: 10.7525/j.issn.1673-5102.2021.04.016
• Research report • Previous Articles Next Articles
Fu-Zhen ZHANG, Fang-Hui LIU, Xin-Xin CHEN, Jing SUN, Rong-Chao GE()
Received:
2020-02-28
Online:
2021-07-20
Published:
2021-03-24
Contact:
Rong-Chao GE
E-mail:grcgp@sina.com
About author:
ZHANG Fu-Zhen(1989—),female,graduate,mainly engaged in salt-related gene cloning and functional studies.
Supported by:
CLC Number:
Fu-Zhen ZHANG, Fang-Hui LIU, Xin-Xin CHEN, Jing SUN, Rong-Chao GE. Cloning and Functional Analysis of Rice Gene OsRPK2[J]. Bulletin of Botanical Research, 2021, 41(4): 604-613.
Add to citation manager EndNote|Ris|BibTeX
URL: https://bbr.nefu.edu.cn/EN/10.7525/j.issn.1673-5102.2021.04.016
Table 1
qRT-PCR primer sequences
基因 Gene | 引物序列 Primer sequence |
---|---|
OsRPK2 | 5′GGAAATGGCTTCAACATTGTTGCC3′ 5′CCTTTAGTCGTCGAACAACTTGC3′ |
P5CS1 | 5′GGTTTCCGATTTGGACTTGGTGCAG3′ 5′CCATTGTCTCCGTCGACAACTTGTC3′ |
ADH1 | 5′GACGATGCCTTCAAGACTCATCCGAT3′ 5′CCTTGTTGATTTCCGAGAATGGCACTGT3′ |
FRY | 5′GTGTCAAAGCTCCACCAGTCCGTATT3′ 5′CGCCTCTGTAACAACTATAGCACCAG3′ |
SAD1 | 5′CCGAATATGGAGATAAGGAGCTCGTTG3′ 5′GGCGATGTTGTTGCCATTGAGTAGAATC3′ |
SOS3 | 5′CGCTTCTTCACGAATCCGAACTAGTTC3′ 5′GGCAAAGTCATGTTCTTGATGAGCGATG3′ |
RD29B | 5′GGTCACTTCTTGGCTCGGTGGT3′ 5′TCCCAACACTTCCTCCGGAATCC3′ |
Esk | 5′GTAGCGTATAGGAGAGTGATGAGGACTT3′ 5′CCTACGCTGAATGGCATTGACATGTTTAG3′ |
β-Actin | 5′TACAGTGTCTGGATCGGTGGTTCC3′ 5′TGTGAACGATTCCTGGACCTGCC3′ |
1 | Morillo S A,Tax F E. Functional analysis of receptor-like kinases in monocots and dicots[J].Current Opinion in Plant Biology,2006,9(5):460-469. |
2 | Shiu S H,Bleecker A B.Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases[J].Proceedings of the National Academy of Sciences of the United States of America,2001,98(19):10763-10768. |
3 | Walker J C,Zhang R.Relationship of a putative receptor protein kinase from maize to the S-locus glycoproteins of Brassica[J].Nature,1990,345(6277):743-746. |
4 | Gish L A,Clark S E.The RLK/Pelle family of kinases[J].The Plant Journal,2011,66(1):117-127. |
5 | Di Gaspero G,Cipriani G.Nucleotide binding site/leucine-rich repeats,Pto-like and receptor-like kinases related to disease resistance in grapevine[J].Molecular Genetics and Genomics,2003,269(5):612-623. |
6 | Becraft P W,Stinard P S,Mccarty D R.CRINKLY4:A TNFR-Like receptor kinase involved in maize epidermal differentiation[J].Science,1996,273(5280):1406-1409. |
7 | Jurca M E,Bottka S,Fehér A.Characterization of a family of Arabidopsis receptor-like cytoplasmic kinases(RLCK class VI)[J].Plant Cell Reports,2008,27(4):739-748. |
8 | Lajkó D B,Valkai I,Domoki M,et al.In silico identification and experimental validation of amino acid motifs required for the Rho-of-plants GTPase-mediated activation of receptor-like cytoplasmic kinases[J].Plant Cell Reports,2018,37(4):627-639. |
9 | Lehti-Shiu M D,Zou C,Shiu S H.Origin,diversity,historyexpansion,and functional evolution of the plant receptor-like kinase/pelle family[M].//Tax F,Kemmerling B.Receptor-like kinases in plants.Berlin,Heidelberg:Springer,2012. |
10 | Shiu S H,Karlowski W M,Pan R S,et al.Comparative analysis of the receptor-like kinase family in Arabidopsis and rice[J].The Plant Cell,2004,16(5):1220-1234. |
11 | Zou Y,Liu X Y,Wang Q,et al.OsRPK1,a novel leucine-rich repeat receptor-like kinase,negatively regulates polar auxin transport and root development in rice[J].Biochimica et Biophysica Acta(BBA)-General Subjects,2014,1840(6):1676-1685. |
12 | Hove C A T,Bochdanovits Z,Jansweijer V M A,et al.Probing the roles of LRR RLK genes in Arabidopsis thaliana roots using a custom T-DNA insertion set[J].Plant Molecular Biology,2011,76(1-2):69-83. |
13 | Torii K U.Leucine-rich repeat receptor kinases in plants:structure,function,and signal transduction pathways[J].International Review of Cytology,2004,234:1-46. |
14 | Nam K H,Li J M.BRI1/BAK1,a receptor kinase pair mediating brassinosteroid signaling[J].Cell,2002,110(2):203-212. |
15 | Li J,Wen J Q,Lease K A,et al.BAK1,an Arabidopsis LRR receptor-like protein kinase,interacts with BRI1 and modulates brassinosteroid signaling[J].Cell,2002,110(2):213-222. |
16 | Li J.Multi-tasking of somatic embryogenesis receptor-like protein kinases[J].Current Opinion in Plant Biology,2010,13(5):509-514. |
17 | Dunning F M,Sun W X,Jansen K L,et al.Identification and mutational analysis of Arabidopsis FLS2 leucine-rich repeat domain residues that contribute to flagellin perception[J].The Plant Cell,2007,19(10):3297-3313. |
18 | Roux M,Schwessinger B,Albrecht C,et al.The Arabidopsis Leucine-rich repeat receptor-like kinases BAK1/SERK3 and BKK1/SERK4 are required for innate immunity to hemibiotrophic and biotrophic pathogens[J].The Plant Cell,2011,23(6):2440-2455. |
19 | Dievart A,Perin C,Hirsch J,et al.The phenome analysis of mutant alleles in Leucine-Rich Repeat Receptor-Like Kinase genes in rice reveals new potential targets for stress tolerant cereals[J].Plant Science,2016,242:240-249. |
20 | Shimizu N,Ishida T,Yamada M,et al.BAM 1 and RECEPTOR‐LIKE PROTEIN KINASE 2 constitute a signaling pathway and modulate CLE peptide‐triggered growth inhibition in Arabidopsis root[J].New Phytologist,2015,208:1104-1113. |
21 | Tanaka H,Osakabe Y,Katsura S,et al.Abiotic stress-inducible receptor-like kinases negatively control ABA signaling in Arabidopsis[J].The Plant Journal,2012,70(4):599-613. |
22 | Hua D P,Wang C,He J N,et al.A plasma membrane receptor kinase,GHR1,mediates abscisic acid-and hydrogen peroxide-regulated stomatal movement in Arabidopsis[J].The Plant Cell,2012,24(6):2546-2561. |
23 | Yang T B,Chaudhuri S,Yang L H,et al.A calcium/calmodulin-regulated member of the receptor-like kinase family confers cold tolerance in plants[J].Journal of Biological Chemistry,2010,285(10):7119-7126. |
24 | Sicilia A,Testa G,Santoro D F,et al.RNASeq analysis of giant cane reveals the leaf transcriptome dynamics under long-term salt stress[J].BMC Plant Biology,2019,19(1):355. |
25 | Song W Y,Wang G L,Chen L L,et al.A receptor kinase-like protein encoded by the rice disease resistance gene,Xa21[J].Science,1995,270(5243):1804-1806. |
26 | Kobe B,Deisenhofer J.The leucine-rich repeat:a versatile binding motif[J].Trends in Biochemical Sciences,1994,19(10):415-421. |
27 | Park S,Moon J C,Park Y C,et al.Molecular dissection of the response of a rice leucine-rich repeat receptor-like kinase(LRR-RLK) gene to abiotic stresses[J].Journal of Plant Physiology,2014,171(17):1645-1653. |
28 | Marshall A,Aalen R B,Audenaert D,et al.Tackling drought stress:RECEPTOR-LIKE KINASES present new approaches[J].The Plant Cell,2012,24(6):2262-2278. |
29 | Osakabe Y,Maruyama K,Seki M,et al.Leucine-rich repeat receptor-like kinase1 is a key membrane-bound regulator of Abscisic acid early signaling in Arabidopsis[J].The Plant Cell,2005,17(4):1105-1119. |
30 | Osakabe Y,Mizuno S,Tanaka H,et al.Overproduction of the membrane-bound receptor-like protein kinase 1,RPK1,enhances abiotic stress tolerance in Arabidopsis[J].Journal of Biological Chemistry,2010,285(12):9190-9201. |
31 | Shi C C,Feng C C,Yang M M,et al.Overexpression of the receptor-like protein kinase genes AtRPK1 and OsRPK1 reduces the salt tolerance of Arabidopsis thaliana[J].Plant Science,2014,217-218:63-70. |
32 | 张志良,瞿伟菁,李小方.植物生理学实验指导[M].4版.北京:高等教育出版社,2009. |
Zhang Z L,Zhai W J,LI X F.Experimental guidance for plant physiology[M].4th ed.Beijing:Higher Education Press,2009. | |
33 | Arnon D I.Copper enzymes in isolated chloroplasts.Polyphenoloxidase in Beta vulgaris[J].Plant Physiology,1949,24(1):1-15. |
34 | Troll W,Lindsley J.A photometric method for the determination of proline[J].The Journal of Biological Chemistry,1955,215(2):655-660. |
35 | Zhu J K.Plant salt tolerance[J].Trends in Plant Science,2001,6(2):66-71. |
36 | Sun X L,Sun M Z,Luo X,et al.A Glycine soja ABA-responsive receptor-like cytoplasmic kinase,GsRLCK,positively controls plant tolerance to salt and drought stresses[J].Planta,2013,237(6):1527-1545. |
37 | Wang J,Li C C,Yao X H,et al.The Antarctic moss leucine-rich repeat receptor-like kinase(PnLRR-RLK2) functions in salinity and drought stress adaptation[J].Polar Biology,2018,41(2):353-364. |
38 | An S H,Choi H W,Hwang I S,et al.A novel pepper membrane-located receptor-like protein gene CaMRP1 is required for disease susceptibility,methyl jasmonate insensitivity and salt tolerance[J].Plant Molecular Biology,2008,67(5):519-533. |
39 | Hong S W,Jon J H,Kwak J M,et al.Identification of a receptor-like protein kinase gene rapidly induced by abscisic acid,dehydration,high salt,and cold treatments in Arabidopsis thaliana[J].Plant Physiology,1997,113(4):1203-1212. |
40 | Xiong L M,Lee B H,Ishitani M,et al.FIERY1 encoding an inositol polyphosphate 1-phosphatase is a negative regulator of abscisic acid and stress signaling in Arabidopsis[J].Genes & Development,2001,15(15):1971-1984. |
41 | González-García M P,Rodríguez D,Nicolás C,et al.Negative regulation of abscisic acid signaling by the Fagus sylvatica FsPP2C1 plays a role in seed dormancy regulation and promotion of seed germination[J].Plant Physiology,2003,133(1):135-144. |
42 | Yamaguchi-Shinozaki K,Shinozaki K.Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses[J].Annual Review of Plant Biology,2006,57:781-803. |
[1] | WANG Hui;ZHOU Shou-Biao*;SHI Guo-Qin. Structure of Vegetative Organs of Eremochloa ophiuroides and Zoysia japonica Related with Resistance [J]. Bulletin of Botanical Research, 2007, 27(6): 701-707. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||